Discovery of Cytospora species associated with canker disease of tree hosts from Mount Dongling of China Author Zhu, Haiyan Author Pan, Meng Author Bezerra, Jadson D. P. Author Tian, Chengming Author Fan, Xinlei text MycoKeys 2020 62 97 121 http://dx.doi.org/10.3897/mycokeys.62.47854 journal article http://dx.doi.org/10.3897/mycokeys.62.47854 1314-4049-62-97 0CDEF6D5DE4451A181F8818FFC66ACD9

Table 2. Genes used in this study with PCR primers, primer DNA sequence, optimal annealing temperature and corresponding references.
Locus	Definition	Primers	Primer DNA sequence (5'-3')	Optimal annealing temp (°C)	References of primers used
ITS	internal transcribed spacer of ribosomal RNA	ITS1	TCCGTAGGTGAACCTGCGG	51	White et al. 1990
ITS	internal transcribed spacer of ribosomal RNA	ITS4	TCCTCCGCTTTTGATATGC	51	White et al. 1990
LSU	large subunit of ribosomal RNA	LROR	ACCCGCTGAACTTAAGC	55	Vilgalys and Hester 1990
LSU	large subunit of ribosomal RNA	LR7	TACTACCACCAAGATCT	55	Vilgalys and Hester 1990
act	actin	ACT-512F	ATGTGCAAGGCCGGTTTCGC	61	Carbone and Kohn 1999
act	actin	ACT-783R	TACGAGTCCTTCTGGCCCAT	61	Carbone and Kohn 1999
rpb2	RNA polymerase II second largest subunit	RPB2-5F	GA(T/C)GA(T/C)(A/C)G(A/T)GATCA(T/C)TT(T/C)GG	52	Liu et al. 1999
rpb2	RNA polymerase II second largest subunit	RPB2-7cR	CCCAT(A/G)GCTTG(T/C)TT(A/G)CCCAT	52	Liu et al. 1999
tef-1α	translation elongation factor 1-alpha	EF1-668F	CGGTCACTTGATCTACAAGTGC	55	Alves et al. 2008
tef-1α	translation elongation factor 1-alpha	EF1-1251R	CCTCGAACTCACCAGTACCG	55	Alves et al. 2008
tub2	beta-tubulin	Bt2a	GGTAACCAAATCGGTGCTGCTTTG	55	Glass and Donaldson 1995
tub2	beta-tubulin	Bt2b	ACCCTCAGTGTAGTGACCCTTGGC	55	Glass and Donaldson 1995