Ulva L. biodiversity in the central Mediterranean Sea: cryptic species and new records Author Bartolo, Angela G. School of Biological Sciences, University of Aberdeen, Cruickshank Building, St. Machar Drive, Aberdeen AB 24 3 UU, Scotland (United Kingdom) and Laboratory of Applied Phycology, Centre for Molecular Medicine & Biobanking, Fourth floor, Biomedical Sciences Building, University of Malta, Msida, MSD 2080 (Malta) angiebartolo @ gmail. com (corresponding author) Author Zammit, Gabrielle Laboratory of Applied Phycology, Centre for Molecular Medicine & Biobanking, Fourth floor, Biomedical Sciences Building, University of Malta, Msida, MSD 2080 (Malta) and Microbiology Lab, Department of Biology, Second floor, Biomedical Sciences Building, Faculty of Science, University of Malta, Msida, MSD 2080 (Malta) Author Küpper, Frithjof C. School of Biological Sciences, University of Aberdeen, Cruickshank Building, St. Machar Drive, Aberdeen AB 24 3 UU, Scotland (United Kingdom) and Marine Biodiscovery Centre, Department of Chemistry, University of Aberdeen, Aberdeen AB 24 3 UE, Scotland (United Kingdom) * Both these authors have contributed equally to this study. text Cryptogamie, Algologie 2022 2022-12-14 20 14 215 225 http://dx.doi.org/10.5252/cryptogamie-algologie2022v43a14 journal article 10.5252/cryptogamie-algologie2022v43a14 1776-0992 7819486

TABLE 2. — Details of the primers used in this study.

Gene	Primer Name Primer no.		Sequence	Reference
tuf A	tuf GF4	1	GGNGCNGCNCAAATGGAYGG	Saunders & Kucera 2010
	tuf AR	2	CCTTCNCGAATMGCRAAWCGC	Saunders & Kucera 2010
ITS1+ 5.8S +ITS2 CladoITS-9Fshort		3	GTCGCTCCTACCGATTGGGTGTG	Hayakawa et al. 2012; Taylor et al. 2017
	CladoITS-7R	4	TCCCTTTTCGCTCGCCGTTACTA	Hayakawa et al. 2012; Taylor et al. 2017
rbc L-3P	G rbc LFi	5	TCTCARCCWTTYATGCGTTGG	Saunders & Kucera 2010
	1385R	6	AATTCAAATTTAATTTCTTTCC	Manhart 1994; Saunders & Kucera 2010