A new species of upland Stream Toad of the genus Ansonia Stoliczka, 1870 (Anura: Bufonidae) from northeastern Peninsular Malaysia Author Chan, Kin Onn Author Wood Jr, Perry L. Author Anuar, Shahrul Author Muin, Mohd Abdul Author Quah, Evan S. H. Author Sumarli, Alexandra X. Y. Author Grismer, L. Lee text Zootaxa 2014 3764 4 427 440 journal article 46468 10.11646/zootaxa.3764.4.3 9dc5d2f3-c7e3-425b-9f51-0100b5bd2455 1175-5326 230623 04036FAE-6FF1-4ADB-AA0F-4C60DBF55BCE

TABLE 1. Primers used in this study for PCR amplification and sequencing reactions.

Primer	Location	Primer sequence 5'–3'	Primer reference
ThrLm	External	AAARCATKGGTCTTGTAARCC	(Matsui et al. 2010)
Hedges16H1	External	CTCCGGTCTGAACTCAGATCACGTAGG	(Hedges & Maxson 1993)
12S-3H	Internal	CAAGTCCTTTGAGTTTTAAGCT	(Matsui et al. 2010)
12SL1091	Internal	AAACTGGGATTAGATACCCCACTAT	(Matsui et al. 2010)
12StVal-H	Internal	AAGTAGCTCGCTTAGTTTCGG	(Matsui et al. 2010)
12SL2021	Internal	CCTACCGAGCTTAGTRATAGCTGGTT	(Tominaga et al. 2006)
16SH2715	Internal	AAGCTCCATAGGGTCTTCTCGTC	(Tominaga et al. 2006)
16S1M	Internal	CCGACTGTTTACCAAAAACAT	(Fu 2000)