Unravelling the Molecular Identity of Bulgarian Jumping Plant Lice of the Family Aphalaridae (Hemiptera: Psylloidea) Author Pramatarova, Monika Author Burckhardt, Daniel Author Malenovský, Igor Author Gjonov, Ilia Author Schuler, Hannes Author Štarhová Serbina, Liliya text Insects 2024 2024-09-10 15 9 1 22 https://doi.org/10.3390/insects15090683 journal article 314166 10.3390/insects15090683 352a438b-a7ac-4c6c-9734-9decd8c68223 PMC11431860 39336651 15085268

Table 2. PCR primers and conditions.

Gene	Primer Set	Primer Sequence′ (5 ′ –3 ′ )	Amplicon Size (bp)	PCR Conditions	Primer References
	LCOP-F	AGAACWAAYCATAAAAYWATTGG	654	95 ◦ C for 3 min; 35 cycles of 95 ◦ C for 30 s, 50 ◦ C 30 s and 72 ◦ C	[54]
	HCO2198R C_LepFolF	TAAACTTCAGGGTGACCAAAAAATCA ATTCAACCAATCATAAAGATATTGG	658	for 1 min; 72 ◦ C for 10 min 94 ◦ C for 1 min, 5 cycles of 94 ◦ C for 30 s, 45–50 ◦ C for 40 s, 72 ◦ C for 1 min, 30–35 cycles of 94 ◦ C	[58]
				for 30 s, 51–54 ◦ C for 40 s and 72 ◦ C
COI	C_LepFolR LCO1490F	TAAACTTCTGGATGTCCAAAAAATCA GGTCAACAAATCATAAAGATATTGG	654	for 1 min, 72 ◦ C for 10 min 95 ◦ C for 3 min; 35 cycles of 95 ◦ C for 30 s, 51 ◦ C 30 s and 72 ◦ C	[58]
	HCO2198R VpmCOIF2	TAAACTTCAGGGTGACCAAAAAATCA TACCTYTGAATTTGCAATTC	646	for 1 min; 72 ◦ C for 10 min 95 ◦ C for 3 min; 35 cycles of 95 ◦ C for 30 s, 46 ◦ C 30 s and 72 ◦ C	[59]
	VpmCOIR4	AATAARTGTTGGTATAARATAGG		for 1 min; 72 ◦ C for 10 min
	Cytbf	TGAGGNCAAATATCHTTYTGA	393	95 ◦ C for 3 min; 35 cycles of 95 ◦ C for 30 s, 53 ◦ C 30 s and 72 ◦ C	[16, 49]
Cytb	Cytbr CytbnewF2 CytbnewR CytbnewF1	GCAAATARRAARTATCATTCDG TGATTATGRGGAGGDTTYGC GTTGAATATGDATDGGDGTWAC TATGAGGAGGDTTYGCWGTTG	330 248	for 1 min; 72 ◦ C for 10 min 95 ◦ C for 3 min; 35 cycles of 95 ◦ C for 30 s, 53 ◦ C 30 s and 72 ◦ C for 1 min; 72 ◦ C for 10 min 95 ◦ C for 3 min; 35 cycles of 95 ◦ C for 30 s, 53 ◦ C 30 s and 72 ◦ C	This study This study
	CytbnewR	GTTGAATATGDATDGGDGTWAC		for 1 min; 72 ◦ C for 10 min