Tardigrades in the alpine region of Northeast China with an integrative description of Crenubiotus liangshuiensis sp. nov. Author Zhang, Jing-Yu 0000-0003-4595-3211 College of Wildlife and Protected Area, Northeast Forestry University, Harbin, 150040, Heilongjiang, China. zhangjingyu@foxmail.com Author Sun, Xue-Ling 0000-0002-0135-4447 Heilongjiang Provincial Natural Resources Rights and Interests Investigation and Monitoring Institute, Harbin, 150080, Heilongjiang, China. Author Wang, Ning Northeast Institute of Geography and Agroecology, Chinese Academy of Sciences, Harbin, 150040, Heilongjiang, China. Author Hao, Li 0009-0001-8016-7331 College of Wildlife and Protected Area, Northeast Forestry University, Harbin, 150040, Heilongjiang, China. haoli958@sina.com Author Ma, Cheng-Xue 0000-0001-6100-1291 College of Wildlife and Protected Area, Northeast Forestry University, Harbin, 150040, Heilongjiang, China. Author Zhao, Na 0000-0001-9234-4908 College of Life Sciences, Northeast Forestry University, Harbin, 150040, Heilongjiang, China. Author Li, He- Ping 0000-0001-8284-0449 College of Wildlife and Protected Area, Northeast Forestry University, Harbin, 150040, Heilongjiang, China. lihepinghrb2002@nefu.edu.cn Author Zhao, Min 0000-0001-9751-454X College of Life Sciences, Northeast Forestry University, Harbin, 150040, Heilongjiang, China. 55899783@qq.com Author Yang, Sheng-Tao 0009-0005-8462-3890 Heilongjiang Provincial Natural Resources Rights and Interests Investigation and Monitoring Institute, Harbin, 150080, Heilongjiang, China. 13697385@qq.com text Zootaxa 2024 2024-08-02 5492 1 96 108 http://dx.doi.org/10.11646/zootaxa.5492.1.5 journal article 300694 10.11646/zootaxa.5492.1.5 e774f3f0-ca29-4310-bf61-4a31b735c3e3 1175-5326 13212067 336B4DA3-553E-4EAA-9277-272D386378DB

TABLE 1. Primers and references for PCR protocols for amplification of the four DNA fragments sequenced in the study

DNA marker	Primer name and sequence (5’-3’)	Primer source	PCR programme
......continued on the next page
18S rRNA	SSU_F_01	Medlin et al. (1988)	Guidetti et al. (2013)
AACCTGGTTGATCCTGCCAGT
SSU_R_82
TGATCCTTCTGCAGGTTCACC
	SSU_F_04	Kiehl et al. (2007)	Kiehl et al. (2007)
GCTTGTCTCAAAGATTAAGCC
SSU26_R
	CATTCTTGGCAAATGCTTTCG
28S rRNA	28SF0001	Mironov et al.	Mironov et al. (2012)
	ACCCVCYNAATTTAAGCATAT	(2012)
28SR0990
	CCTTGGTCCGTGTTTCAAGAC
COI	LCO1490	Folmer et al. (1994)	Cesari et al. (2009)
GGTCAACAAATCATAAAGATATTGG