Reinstatement of Athis miastagma (Dyar, 1925) (Lepidoptera: Castniidae) as a valid species inhabiting the Pacific slope of Central Mexico Author González, Jorge M. Austin Achieve Public Schools, Austin, Texas, (Research Associate, McGuire Center for Lepidoptera and Biodiversity), USA. Sociedad Mexicana de Lepidopterología A. C. Author López, Bernardo 0000-0001-9832-3921 berlopezg @ yahoo. com. mx; https: // orcid. org / 0000 - 0001 - 9832 - 3921 berlopezg@yahoo.com.mx Author Díaz, José De Jesús García 0000-0002-3559-8204 chuchogd @ live. com. mx; https: // orcid. org / 0000 - 0002 - 3559 - 8204 chuchogd@live.com.mx Author Simon, Sabrina Biosystematics Group, Wageningen University, and Research, Wageningen, Netherlands Author Sarto, Víctor Institute of Environmental Science and Technology, Universitat Autònoma de Barcelona, Edifici Z, Bellaterra 08193, Spain and Departament d’Agricultura, Ramaderia, Pesca, Alimentació i Medi Natural Generalitat de Catalunya, Avinguda Meridiana, 38 08018 Barcelona, Spain Author Worthy, Robert 10 The Hill, Church Hill, Caterham, Surrey CR 3 6 SD, U. K. text Zootaxa 2021 2021-11-04 5061 2 300 322 journal article 3584 10.11646/zootaxa.5061.2.4 94b08d35-6b09-411b-94b8-2e3a0d10c373 1175-5326 5649512 A68A7E72-DF2E-471A-A141-BBF3C1DE0DCD
TABLE 3. Character-based DNA barcodes (nucleotides) at 25 selected positions of the CO1 barcode region; sequences analyzed per species are given in brackets.
Taxa/Position529192112154190197202263265271280287328337343367397403487514520586610616
Athis hechtiae (2)CCCTCACCCTTATTACTCGTATACC
Athis miastagma (6)ATTCTTTTTAACCATTCTACTATTT