What was known as Rhyothemis variegata (Linnaeus, 1763) and R. phyllis (Sulzer, 1776) (Odonata, Libellulidae) are the same species Author Kosterin, Oleg E. 0000-0001-5955-4057 Institute of Cytology & Genetics SB RAS, Acad. Lavrentyev ave. 10, Novosibirsk, 630090, Russia; Novosibirsk State University, Pirogova street 2, Novosibirsk, 630090, Russia kosterin@bionet.nsc.ru Author Vshivtseva, Ekaterina I. 0009-0009-4014-6366 Institute of Cytology & Genetics SB RAS, Acad. Lavrentyev ave. 10, Novosibirsk, 630090, Russia; Novosibirsk State University, Pirogova street 2, Novosibirsk, 630090, Russia VshivtsevaEI@bionet.nsc.ru Author Blinov, Alexander G. 0000-0002-4971-6312 Institute of Cytology & Genetics SB RAS, Acad. Lavrentyev ave. 10, Novosibirsk, 630090, Russia; Institute of Molecular and Cellular Biology SB RAS, Acad. Lavrentyev ave. 8 / 2, Novosibirsk, 630090, Russia blinov@bionet.nsc.ru text Zootaxa 2025 2025-12-04 5725 4 567 582 https://doi.org/10.11646/zootaxa.5725.4.7 journal article 313645 10.11646/zootaxa.5725.4.7 5b6fdd6f-2915-48c0-8c59-8290eb7dbe71 1175-5326 17870208 EDEFB317-ACEA-4A7C-A04C-F6C0BE64245E
TABLE 1. Primers used for PCR and sequencing in the present study.
gene/markerprimer namesequence (5’ to 3’)reference
histone H3–H4 regionHex_ARATATCCTTGGGCATGATGGTGACMglinets et al. 2025
histone H3–H4 regionLH4_2RTTAACCGCCGAAACCGTACAGGGTMglinets et al. 2025
COI911TTTCTACAAATCATAAAGATATTGGFolmer et al. 1994
COI912TAAACTTCAGGGTGACCAAAAAATCFolmer et al. 1994